Flag of the European Union EU Clinical Trials Register Help

Clinical trials

The European Union Clinical Trials Register   allows you to search for protocol and results information on:
  • interventional clinical trials that were approved in the European Union (EU)/European Economic Area (EEA) under the Clinical Trials Directive 2001/20/EC
  • clinical trials conducted outside the EU/EEA that are linked to European paediatric-medicine development

  • EU/EEA interventional clinical trials approved under or transitioned to the Clinical Trial Regulation 536/2014 are publicly accessible through the
    Clinical Trials Information System (CTIS).


    The EU Clinical Trials Register currently displays   44346   clinical trials with a EudraCT protocol, of which   7374   are clinical trials conducted with subjects less than 18 years old.   The register also displays information on   18700   older paediatric trials (in scope of Article 45 of the Paediatric Regulation (EC) No 1901/2006).

    Phase 1 trials conducted solely on adults and that are not part of an agreed paediatric investigation plan (PIP) are not publicly available (see Frequently Asked Questions ).  
     
    Examples: Cancer AND drug name. Pneumonia AND sponsor name.
    How to search [pdf]
    Search Tips: Under advanced search you can use filters for Country, Age Group, Gender, Trial Phase, Trial Status, Date Range, Rare Diseases and Orphan Designation. For these items you should use the filters and not add them to your search terms in the text field.
    Advanced Search: Search tools
     

    < Back to search results

    Download PDF

    Clinical Trial Results:
    Treatment Resistance Following Anti-Cancer Therapies

    Summary
    EudraCT number
    2018-003612-45
    Trial protocol
    AT   ES  
    Global end of trial date
    14 Dec 2020

    Results information
    Results version number
    v1(current)
    This version publication date
    22 Dec 2021
    First version publication date
    22 Dec 2021
    Other versions

    Trial information

    Close Top of page
    Trial identification
    Sponsor protocol code
    A9001502
    Additional study identifiers
    ISRCTN number
    -
    US NCT number
    NCT04436120
    WHO universal trial number (UTN)
    -
    Sponsors
    Sponsor organisation name
    Pfizer, Inc.
    Sponsor organisation address
    235 E 42nd Street, New York, United States, NY 10017
    Public contact
    Pfizer ClinicalTrials.gov Call Center, Pfizer, Inc., +1 8007181021, ClinicalTrials.gov_Inquiries@pfizer.com
    Scientific contact
    Pfizer ClinicalTrials.gov Call Center, Pfizer, Inc., +1 8007181021, ClinicalTrials.gov_Inquiries@pfizer.com
    Paediatric regulatory details
    Is trial part of an agreed paediatric investigation plan (PIP)
    No
    Does article 45 of REGULATION (EC) No 1901/2006 apply to this trial?
    No
    Does article 46 of REGULATION (EC) No 1901/2006 apply to this trial?
    No
    Results analysis stage
    Analysis stage
    Final
    Date of interim/final analysis
    14 Dec 2020
    Is this the analysis of the primary completion data?
    Yes
    Primary completion date
    14 Dec 2020
    Global end of trial reached?
    Yes
    Global end of trial date
    14 Dec 2020
    Was the trial ended prematurely?
    Yes
    General information about the trial
    Main objective of the trial
    The primary objective is to obtain and analyze archival pre-treatment tumor samples and post-progression tumor biopsies to identify molecular markers of resistance to selected anti-cancer therapies.
    Protection of trial subjects
    This study was conducted in compliance with the ethical principles originating in or derived from the Declaration of Helsinki and in compliance with all International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) Good Clinical Practice (GCP) Guidelines. In addition, all local regulatory requirements were followed, in particular, those affording greater protection to the safety of trial subjects.
    Background therapy
    -
    Evidence for comparator
    -
    Actual start date of recruitment
    13 Feb 2019
    Long term follow-up planned
    No
    Independent data monitoring committee (IDMC) involvement?
    No
    Population of trial subjects
    Number of subjects enrolled per country
    Country: Number of subjects enrolled
    Argentina: 6
    Country: Number of subjects enrolled
    Belgium: 4
    Country: Number of subjects enrolled
    France: 13
    Country: Number of subjects enrolled
    United Kingdom: 2
    Country: Number of subjects enrolled
    United States: 11
    Worldwide total number of subjects
    36
    EEA total number of subjects
    17
    Number of subjects enrolled per age group
    In utero
    0
    Preterm newborn - gestational age < 37 wk
    0
    Newborns (0-27 days)
    0
    Infants and toddlers (28 days-23 months)
    0
    Children (2-11 years)
    0
    Adolescents (12-17 years)
    0
    Adults (18-64 years)
    14
    From 65 to 84 years
    22
    85 years and over
    0

    Subject disposition

    Close Top of page
    Recruitment
    Recruitment details
    Of 97 subjects screened, 38 were enrolled into 7 cohorts. Only 36 subjects in the Safety Analysis (SA) population enrolled and for whom a de novo biopsy procedure or research blood draw was performed were analyzed. No subjects discontinued from study due to adverse events (AEs).There was no study drug or study device involved in this study.

    Pre-assignment
    Screening details
    There were 38 subjects enrolled at 24 sites and only 36 subjects were included in the SA population who had de novo biopsy or research blood draw performed.

    Period 1
    Period 1 title
    Overall Study (overall period)
    Is this the baseline period?
    Yes
    Allocation method
    Not applicable
    Blinding used
    Not blinded

    Arms
    Are arms mutually exclusive
    No

    Arm title
    Cohort 1: Non-small cell lung carcinoma (NSCLC) monotherapy
    Arm description
    Progressive disease on 1st line monotherapy anti-programmed cell death receptor 1 or programmed cell death ligand 1 (anti-PD-1/-L1).
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    Pharmaceutical Forms was not applicable. Choose cohort 1 was meaningless, at least one arm should be chosen in this section, otherwise there would be an error.
    Investigational medicinal product code
    Other name
    Pharmaceutical forms
    Anticoagulant and preservative solution for blood
    Routes of administration
    Not mentioned
    Dosage and administration details
    NA

    Arm title
    Cohort 2: NSCLC combination
    Arm description
    Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    Cohort 3: Renal cell carcinoma (RCC) with clear cell component
    Arm description
    Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    Cohort 4: HR+ HER2- adenocarcinoma of the breast
    Arm description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    Cohort 5: Castrate-resistant adenocarcinoma of the prostate
    Arm description
    Progressive disease on enzalutamide monotherapy.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    Cohort 6: Castrate-resistant adenocarcinoma of the prostate
    Arm description
    Progressive disease on abiraterone in combination with prednisone.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Arm description
    Progressive disease on a poly ADP-ribose polymerase (PARP) inhibitor monotherapy in subjects previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The biomarker evaluable target (BET) Populations in Cohort 4
    Arm description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BET (whole exome tumor DNA [WETD]) Populations in Cohort 4
    Arm description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BE [targeted blood cfDNA (TBD)] Populations in Cohort 4
    Arm description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BE (TBD) Populations in Cohort 5 & 6
    Arm description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BET Populations in Cohort 5 & 6
    Arm description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BET (WETD) Populations in Cohort 5 & 6
    Arm description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BET [targeted tumor RNA (TTR)] Populations in Cohort 5 & 6
    Arm description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Arm title
    The BET [WTTR] Populations in Cohort 5 & 6
    Arm description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.
    Arm type
    Tumor biopsy and blood draw

    Investigational medicinal product name
    No investigational medicinal product assigned in this arm
    Number of subjects in period 1
    Cohort 1: Non-small cell lung carcinoma (NSCLC) monotherapy Cohort 2: NSCLC combination Cohort 3: Renal cell carcinoma (RCC) with clear cell component Cohort 4: HR+ HER2- adenocarcinoma of the breast Cohort 5: Castrate-resistant adenocarcinoma of the prostate Cohort 6: Castrate-resistant adenocarcinoma of the prostate Cohort 7: gBRCAm HER2- adenocarcinoma of the breast The biomarker evaluable target (BET) Populations in Cohort 4 The BET (whole exome tumor DNA [WETD]) Populations in Cohort 4 The BE [targeted blood cfDNA (TBD)] Populations in Cohort 4 The BE (TBD) Populations in Cohort 5 & 6 The BET Populations in Cohort 5 & 6 The BET (WETD) Populations in Cohort 5 & 6 The BET [targeted tumor RNA (TTR)] Populations in Cohort 5 & 6 The BET [WTTR] Populations in Cohort 5 & 6
    Started
    1
    4
    5
    11
    5
    11
    1
    6
    3
    8
    10
    6
    2
    2
    6
    Completed
    1
    4
    5
    10
    5
    10
    1
    6
    3
    8
    10
    6
    2
    2
    6
    Not completed
    0
    0
    0
    1
    0
    1
    0
    0
    0
    0
    0
    0
    0
    0
    0
         Lost to follow-up
    -
    -
    -
    1
    -
    1
    -
    -
    -
    -
    -
    -
    -
    -
    -

    Baseline characteristics

    Close Top of page
    Baseline characteristics reporting groups
    Reporting group title
    Overall Study
    Reporting group description
    36 subjects were SA populations who had de novo biopsy or research blood draw performed.

    Reporting group values
    Overall Study Total
    Number of subjects
    36 36
    Age categorical
    Units: Subjects
        In utero
    0 0
        Preterm newborn infants (gestational age < 37 wks)
    0 0
        Newborns (0-27 days)
    0 0
        Infants and toddlers (28 days-23 months)
    0 0
        Children (2-11 years)
    0 0
        Adolescents (12-17 years)
    0 0
        Adults (18-64 years)
    14 14
        From 65-84 years
    22 22
        85 years and over
    0 0
    Age Continuous
    Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population
    Units: Years
        arithmetic mean (standard deviation)
    67.1 ( 8.99 ) -
    Sex: Female, Male
    Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population
    Units: Subjects
        Female
    12 12
        Male
    24 24
    Race/Ethnicity, Customized
    Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population
    Units: Subjects
        White
    28 28
        Multiracial
    1 1
        Not reported
    7 7
    Ethnicity (NIH/OMB)
    Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population
    Units: Subjects
        Hispanic or Latino
    6 6
        Not Hispanic or Latino
    18 18
        Unknown or Not Reported
    12 12

    End points

    Close Top of page
    End points reporting groups
    Reporting group title
    Cohort 1: Non-small cell lung carcinoma (NSCLC) monotherapy
    Reporting group description
    Progressive disease on 1st line monotherapy anti-programmed cell death receptor 1 or programmed cell death ligand 1 (anti-PD-1/-L1).

    Reporting group title
    Cohort 2: NSCLC combination
    Reporting group description
    Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.

    Reporting group title
    Cohort 3: Renal cell carcinoma (RCC) with clear cell component
    Reporting group description
    Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.

    Reporting group title
    Cohort 4: HR+ HER2- adenocarcinoma of the breast
    Reporting group description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.

    Reporting group title
    Cohort 5: Castrate-resistant adenocarcinoma of the prostate
    Reporting group description
    Progressive disease on enzalutamide monotherapy.

    Reporting group title
    Cohort 6: Castrate-resistant adenocarcinoma of the prostate
    Reporting group description
    Progressive disease on abiraterone in combination with prednisone.

    Reporting group title
    Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Reporting group description
    Progressive disease on a poly ADP-ribose polymerase (PARP) inhibitor monotherapy in subjects previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.

    Reporting group title
    The biomarker evaluable target (BET) Populations in Cohort 4
    Reporting group description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.

    Reporting group title
    The BET (whole exome tumor DNA [WETD]) Populations in Cohort 4
    Reporting group description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.

    Reporting group title
    The BE [targeted blood cfDNA (TBD)] Populations in Cohort 4
    Reporting group description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.

    Reporting group title
    The BE (TBD) Populations in Cohort 5 & 6
    Reporting group description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.

    Reporting group title
    The BET Populations in Cohort 5 & 6
    Reporting group description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.

    Reporting group title
    The BET (WETD) Populations in Cohort 5 & 6
    Reporting group description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.

    Reporting group title
    The BET [targeted tumor RNA (TTR)] Populations in Cohort 5 & 6
    Reporting group description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.

    Reporting group title
    The BET [WTTR] Populations in Cohort 5 & 6
    Reporting group description
    Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.

    Primary: Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies

    Close Top of page
    End point title
    Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies [1] [2]
    End point description
    Using the targeted panel next-generation sequencing (NGS) to analyze mutation frequency between the archival and de novo tumor samples in the biomarker evaluable target (BET) populations of Cohort 4 (N=6) and Cohort 5&6 (N=6), using the whole exome sequencing NGS to analyze mutation frequency between the archival and de novo tumor biopsies in the BET (whole exome tumor DNA [WETD]) populations of Cohort 4 (N=3) and Cohort 5&6 (N=2). Biomarker evaluable target (BET) Population and BET (whole exome tumor DNA [WETD]) Population were analyzed. The BET population was defined as subjects in the BE population who have a targeted tumor DNA panel biomarker result from both the archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all subjects in the BET population who have results of WETD NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen.
    End point type
    Primary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [1] - No statistical analyses have been specified for this primary end point. It is expected there is at least one statistical analysis for each primary end point.
    Justification: Statistic analysis is frequency change and 95% CI in this case.
    [2] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The biomarker evaluable target (BET) Populations in Cohort 4 The BET (whole exome tumor DNA [WETD]) Populations in Cohort 4 The BET Populations in Cohort 5 & 6 The BET (WETD) Populations in Cohort 5 & 6
    Number of subjects analysed
    6
    3
    6
    2
    Units: Percentage of subjects
    number (confidence interval 95%)
        AKT1 c.238T>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARHGAP39 c.2000G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARHGAP39 c.2085G>C
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARID1A c.3145_3146dupCT
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARID1A c.3977dupC
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARID2 c.1803dupG
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ASXL1 c.1934dupG
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATM c.5557G>A
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATM c.5948A>G
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        AXIN1 c.1881G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BAP1 c.179G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BCLAF1 c.615_619delATCAGinsGTCAT
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BCOR c.476C>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRCA1 c.2612C>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        BRCA1 c.3113A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        BRCA1 c.3548A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        BRCA1 c.4837A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        BRCA1 c.4956G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        BRCA2 c.1114A>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        BRCA2 c.2803G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRCA2 c.7397T>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        BRCA2 c.9976A>T
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRIP1 c.14G>C
    -16.7 (-56.4 to 28.9)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRIP1 c.2755T>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        CBR3 c.730G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCNE1 c.1117G>A
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CD22 c.757G>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CD3EAP c.1516C>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDH1 c.1269delT
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDH1 c.466T>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CREBBP c.1792C>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CSF3R c.14G>T
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DNM2 c.1782-5delC
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DPYD c.1471G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DYNC2H1 c.1714A>G
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ECH1 c.122A>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ERBB2 c.1958C>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ERBB2 c.2446C>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ERCC5 c.440C>G
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ESR1 c.1609T>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ESR1 c.1610_1613delATGAinsGTGG
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ESR1 c.1613A>G
    16.7 (-28.9 to 56.4)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM175A c.826_828delGAG
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FANCA c.2426G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FANCD2 c.1214A>G
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FANCE c.17C>G
    -16.7 (-16.7 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAT1 c.3818A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FGF9 c.375T>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FGFR1 c.358+4G>A
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FGFR1OP c.985-6_985-5dupTT
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FLT4 c.1019G>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXA1 c.247G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXA1 c.801G>T
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXA1 c.874G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXQ1 c.1013A>G
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXQ1 c.895G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FRS2 c.236G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GATA2 c.527C>T
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GATA3 c.1223_1224insA
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GNAS c.521G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GOT2 c.1037T>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HEATR1 c.6347-4_6347-3dupTT
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IRF2 c.744G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IRS2 c.3170G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITPKB c.1222T>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JAK1 c.1252G>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JAK2 c.2743G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JAK3 c.757A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KDM6A c.2859-5delT
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        KDR c.2921G>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KMT2C c.2536delG
    0.0 (-39.0 to 39.0)
    0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KMT2C c.4270C>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LMAN1 c.823-2dupA
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRP1B c.143A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRP1B c.5737G>A
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LTN1 c.1717A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LYN c.475G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAP2K4 c.179C>A
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MED12 c.1364G>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MGMT c.520A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MGMT c.626A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MLH1 c.655A>G
    16.7 (-28.9 to 56.4)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MSH2 c.1748A>G
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MSH6 c.116G>A
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        MSH6 c.3557-4dupT
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MTHFR c.1286A>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUTYH c.1014G>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MUTYH c.1187G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MYB c.1781C>G
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NBN c.553G>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    -33.3 (-70.0 to 18.7)
    0.0 (-65.8 to 65.8)
        NBN c.683T>G
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NCOR1 c.4135G>T
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NCOR2 c.1597G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NF1 c.7063-1G>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NF1 c.849T>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NOTCH1 c.2588-4G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NOTCH2 c.3522+3G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NOTCH3 c.539C>T
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NTRK1 c.1806-4delA
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUP98 c.3310G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PALB2 c.1676A>G
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        PALB2 c.2014G>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        PIK3CA c.1035T>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIK3CA c.1633G>A
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIK3CA c.3140A>G
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIK3CG c.41A>G
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLCG2 c.2011A>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PMS2 c.13G>C
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PMS2 c.1408C>T
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        PMS2 c.1454C>A
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PMS2 c.1621A>G
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        PMS2 c.2570G>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    33.3 (-18.7 to 70.0)
    50.0 (-48.6 to 90.5)
        PMS2 c.89A>G
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        POLD1 c.2959delG
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PRKDC c.6424C>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTCH1 c.3746C>T
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTCH2 c.2134G>A
    0.0 (-39.0 to 39.0)
    0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTPN13 c.4097T>A
    -16.7 (-56.4 to 28.9)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTPN13 c.5683A>T
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTPN13 c.6256T>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PUS3 c.1380G>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RAD51C c.376G>A
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        RAD51D c.494G>A
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RIT1 c.625G>C
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNF43 c.1252C>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ROS1 c.1775_1777delGTG
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RSF1 c.3025G>C
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SF3B1 c.2077+4A>G
    16.7 (-28.9 to 56.4)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SOD2 c.47T>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SYNE1 c.18758G>A
    16.7 (-28.9 to 56.4)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TBC1D12 c.1246C>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TBC1D9B c.3356A>C
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TBX3 c.364G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TBX3 c.820_827dupCCCGAAAC
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TCF3 c.737C>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TERT c.215G>A
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TGFBR2 c.530-4T>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        TP53 c.215C>G
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        TP53 c.388delC
    0.0 (-39.0 to 39.0)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TP53 c.782+1G>A
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TUSC3 c.99_101delGCT
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZFHX3 c.10931G>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZFHX3 c.1135C>G
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZFHX3 c.1631C>T
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZFHX3 c.2833T>G
    -16.7 (-56.4 to 28.9)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ALK c.1043C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        APLNR c.349G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        CARD11 c.988G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        CHD4 c.4060G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    0.0 (-65.8 to 65.8)
        EGFR c.1008G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        EP300 c.6613A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        ERCC6 c.3661C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        ERG c.1455_1461delCTACTAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        EZH2 c.848C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        FBXO11 c.164_169delAGCAGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        FLT4 c.2405G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        FOXO1 c.302C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        GNAQ c.303C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        HOTS c.233_236delTACTinsCACC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        IRS2 c.1242C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        KDM5C c.3019C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        KIT c.597delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        KMT2A c.9400C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        KMT2B c.26G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        KMT2C c.4845G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    50.0 (-48.6 to 90.5)
        LRP1B c.4439G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MAGEA10 c.1021G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        MAP3K1 c.4292A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MET c.2318C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MSH6 c.1186C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MSH6 c.1486T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        MUTYH c.64G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        MYH11 c.5819dupC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        NF1 c.1082G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        NOTCH2 c.17_18delCC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        NTRK3 c.137G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        PALB2 c.2993G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        PALLD c.270_275dupCCCGCC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        PAX8 c.352G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        PDGFRB c.1543G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    -50.0 (-90.5 to 48.6)
        PIK3R1 c.1690A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        PIK3R1 c.935delC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        PIK3R2 c.2047T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    0.0 (-65.8 to 65.8)
        PLCG1 c.1825C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        PLCG2 c.2114G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
        PMS2 c.1789A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        PMS2 c.706-4delT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        PTEN c.900delC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        PTPRD c.2069A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        RB1 c.1466G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    50.0 (-48.6 to 90.5)
        RNF139 c.135C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        ROS1 c.3416A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    50.0 (-48.6 to 90.5)
        SPOP c.260A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        SYNE1 c.25403G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        TCF3 c.1643G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        TEP1 c.3649C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-39.0 to 39.0)
    999999 (999999 to 999999)
        TP53 c.993G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        TP53 c.994-2A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        U2AF1 c.101C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -16.7 (-56.4 to 28.9)
    999999 (999999 to 999999)
        ZFHX3 c.11065A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    16.7 (-28.9 to 56.4)
    999999 (999999 to 999999)
        AATK c.65C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ABCC9 c.4535C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ACADS c.989G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ACAP3 c.1990C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ACSL4 c.106G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADAMTS13 c.3287G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADAMTS7 c.227G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADCY5 c.778C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADGRE2 c.934C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADGRE3 c.1411G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADGRF2 c.680C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADGRG3 c.1394C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ADH4 c.1174delA
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AEBP1 c.799G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AGFG2 c.340C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AGPAT4 c.853C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AGRN c.184C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AGRN c.3157G>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AHNAK2 c.13479G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AHNAK2 c.9650T>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        AKNA c.3907T>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ALS2CL c.14A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ANKRD61 c.323C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ANKS1A c.157_159delGGC
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ANKS1B c.2548C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ANTXR1 c.1121A>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ANTXR2 c.940G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        APC2 c.1312C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        APLP1 c.1243C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARF6 c.352_354delCTC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARHGAP6 c.1585G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARHGEF1 c.2031_2033delGCT
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARHGEF19 c.1379C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARHGEF7 c.2072G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARL10 c.53C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARL6IP4 c.902_904delAGA
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARRDC4 c.227C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ARSI c.312G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ASCC3 c.5962A>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ASH1L c.8522G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ASPRV1 c.985G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATM c.3403-4dupT
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ATP13A2 c.2984C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATP2C2 c.2192delA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATP6AP1 c.508A>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATP7A c.3388C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ATRN c.263_268delCGGCGG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        B3GLCT c.517G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        B4GALNT2 c.1414G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        B4GALT7 c.431T>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BEGAIN c.1231G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BEST1 c.273C>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BET1 c.327dupT
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BNC1 c.86G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BOC c.896G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BPIFB4 c.1146G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRPF1 c.3069C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRPF1 c.823G>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BRWD3 c.3188G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        BTBD17 c.106G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C10orf88 c.401dupA
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C16orf47 c.329G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C16orf95 c.407G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C17orf100 c.71C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C17orf105 c.97G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C1QL4 c.185G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C1orf122 c.17G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C1orf168 c.2134G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C3 c.3566_3567delTG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C5orf60 c.770G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        C7orf31 c.931A>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CACNA1C c.169G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CACNA1D c.26_28delAAA
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CACNA1D c.58C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CACNA1I c.2939G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CACNA1S c.4718C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CAD c.1429G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CADPS c.1595G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CAPS2 c.158C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CARS2 c.1419C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CATSPERE c.2471A>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CC2D1A c.1030C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CC2D2B c.312G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC105 c.895G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC114 c.445G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC142 c.1220G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC168 c.17281G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC22 c.442C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC39 c.1189C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC47 c.21C>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC70 c.239G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC73 c.896C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC8 c.316G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCDC91 c.1163C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CCP110 c.2504G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CD3G c.497G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CD80 c.832G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CD9 c.85C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDC25A c.1517G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDH13 c.1498G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDH23 c.691G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDK18 c.1073G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDKN2A c.23G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CDX4 c.455G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CEBPZ c.2155T>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CELSR3 c.5802delC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CELSR3 c.9748C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CENPE c.2797G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CENPE c.4270C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CENPV c.596C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CEP170B c.1955T>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CEP170B c.3520C>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CEP250 c.589G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CFAP157 c.1441C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CFHR4 c.996C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CGB3 c.427G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHADL c.868C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHCHD10 c.227G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHD2 c.2366G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHD3 c.1796G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHD3 c.3880G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHPF c.2009A>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHRNA5 c.1192G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CHST13 c.716G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CIZ1 c.626G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLCN6 c.698G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLCNKA c.476G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLDN15 c.301C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLEC3A c.547G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLEC4F c.839G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLIP4 c.890G>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLSPN c.533G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLTA c.698G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CLUH c.2743G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CMBL c.460G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CNR1 c.982C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CNTD2 c.164C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL11A2 c.3100C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL1A1 c.3680G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL22A1 c.3584G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL22A1 c.379C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL27A1 c.2295C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL4A1 c.3263G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL6A2 c.1267C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        COL6A5 c.5543G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CRB2 c.2873G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CREB3L1 c.1267C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CRH c.445G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CRYBG2 c.1418_1419ins
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CSMD1 c.1090G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CST9 c.289C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CT55 c.331A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CTAGE4 c.1963A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CTBP1 c.1130C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CTH c.589C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CTNNB1 c.1517T>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CTTNBP2 c.3100G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CX3CL1 c.1130C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CXCR3 c.386G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CYBA c.437G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CYBB c.1461G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CYGB c.406G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        CYP2F1 c.1028G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DAAM1 c.1015C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DAB2 c.2173C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DACH1 c.1726C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DALRD3 c.896A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DDIAS c.2524G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DEF8 c.1414G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DEFB121 c.154G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DENND1A c.1343G>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DENND2C c.794G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DENND4A c.311G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DFFB c.379G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DGAT1 c.458G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DGKI c.40C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DHRSX c.721G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DNAH10 c.3640G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DNAH9 c.1243C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DNAH9 c.6584A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DOCK1 c.5259G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DOCK11 c.307G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DOCK2 c.543C>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DOCK3 c.2086G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DOCK4 c.5740G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DOCK8 c.1205C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        DRAM2 c.133G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        EBPL c.20T>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ECT2 c.619C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        EFHC2 c.679G>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        EFHD1 c.88G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ELMSAN1 c.939dupC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ELOA2 c.1207G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ENC1 c.206G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ENDOG c.142G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ERFE c.467C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ESX1 c.959_985delCTGTGCCACCCGGGCCGCCCATGGCGC
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        EVC c.1168C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        EVC2 c.2095A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        EVI5 c.1213T>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        F8 c.3380G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAAP100 c.22G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM135B c.2615G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM160B2 c.305delC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM161B c.932G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM192A c.634C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM210B c.245A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM212A c.216_218delGGA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM219A c.499G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM220A c.266C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM50B c.307C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM86B2 c.892+5A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FAM89A c.110C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FANCA c.4232C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FASN c.4447G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FASTKD3 c.20G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FBXO3 c.7G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FBXO33 c.101_109delAGCTGCGAC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FBXW10 c.1573G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FBXW12 c.174A>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FBXW9 c.209G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FCF1 c.589C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FDX1L c.494C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FIGNL2 c.856G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FIP1L1 c.1180C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FKBP15 c.3637G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FLG c.5378G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FLII c.668G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FLNA c.6100C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FMR1 c.1544G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXD4 c.748_749delGGinsC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXN4 c.455delC
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FOXO4 c.574C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FRAS1 c.5732A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FRS3 c.1336_1344delACCCACCCTinsCCCCCCCCC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FSCN2 c.853G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FSIP2 c.18617_18618delTA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FSTL1 c.755G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        FUT7 c.49G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GAREM1 c.1673G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GATAD2B c.1704G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GGCT c.206C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GGT5 c.1334C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GGT7 c.1093G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GJA9 c.595G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GLI2 c.4672G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GLRA4 c.440C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GLT8D2 c.278G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GMPPB c.887G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GNB1 c.983C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GOLGA2 c.1483C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GOLGA8K c.1702G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        GOLGA8K c.962A>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GOLIM4 c.949C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GOLM1 c.179G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GP9 c.131C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPC1 c.1030G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR149 c.1041C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR155 c.1384G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR50 c.514G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR52 c.18G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR6 c.715C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR83 c.321C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GPR88 c.568G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GRIA1 c.2318C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GRIA3 c.1913G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GRIA3 c.2431G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GRK7 c.1027G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GRK7 c.146G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GRN c.266C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GSE1 c.1201G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GSG2 c.611G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GTPBP1 c.1339C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GUCY2D c.2035G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        GYG2 c.910C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HCFC1 c.4873G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HCN1 c.808C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HDDC2 c.385G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HDLBP c.1417C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HEPHL1 c.3193G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HES2 c.13C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HGSNAT c.1622C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HINT3 c.10G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HIP1 c.2956G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HIST1H2AL c.186G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HIST2H3D c.19A>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HJURP c.520G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HMGA2 c.275C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HNRNPUL2 c.206G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HOXB9 c.232T>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HOXD4 c.121G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HRG c.988G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HUNK c.1708C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HUWE1 c.11869C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HYAL3 c.428G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        HYDIN c.10541G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ICAM3 c.869G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IFI30 c.34C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IFNA10 c.178C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IFT81 c.1313G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IGFN1 c.5179G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        IGFN1 c.5683T>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    0.0 (-81.1 to 81.1)
        IGFN1 c.5695G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    0.0 (-81.1 to 81.1)
        IGSF9B c.932G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IL12RB1 c.1097C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IL6ST c.1165G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ILF3 c.1480G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        INA c.41_43delCCT
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ING1 c.361C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        INTS9 c.1412G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IQCH c.310C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IQGAP2 c.4025G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        IQSEC3 c.1468G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ISM2 c.701C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITGA1 c.3334G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITGA9 c.1040C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITGA9 c.433C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITGAE c.1350_1352delGGC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITIH5 c.2035C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITLN2 c.176G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ITPK1 c.625G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JMJD7 c.889G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JPH3 c.1412C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JPH3 c.1688G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        JSRP1 c.548C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KANK3 c.304G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KATNA1 c.443G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KCNAB3 c.689G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KCNE5 c.370C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KCNG1 c.1226C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KCNN4 c.264G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KCNQ4 c.2041G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KDM2A c.1939G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KDM6A c.3068G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIAA0586 c.397C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIAA1109 c.3686C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIAA1324 c.1453G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF13A c.517C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF13B c.5231G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF17 c.1204G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF19 c.92C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF1B c.2119A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF1C c.2522C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIF21B c.4303G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KIR2DS4 c.436A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KLK2 c.259G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KMT2A c.5755G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KMT2B c.265G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KNDC1 c.3065C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KRBA1 c.1058C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KRTAP17-1 c.125G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KRTAP17-1 c.140G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        KSR1 c.254C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LAMA5 c.104C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LAMA5 c.7771C>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LAMB2 c.2089C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LCE3D c.221G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LDOC1 c.417C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LEMD3 c.1873C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LINC00452 c.718G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LIPN c.748A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LKAAEAR1 c.182G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LMNA c.1634G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LMNA c.356G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LMTK3 c.1696G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LOC100506388 c.217C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LOC441155 c.35dupT
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LOC729159 c.1004_1005delTGinsCA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LPAR2 c.733A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRP1 c.4006G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRRC32 c.1573C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRRC56 c.899G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRRC59 c.510G>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRRC8D c.914A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRRN4 c.421A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LRRN4 c.442C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LYST c.7192G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        LZTR1 c.1892G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAD2L2 c.76G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MADD c.2251G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAEL c.329T>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAGEA10 c.145C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAGEA5 c.181C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAGEL2 c.2626G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAN2A1 c.1916dupA
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MANEA c.1096C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAP7D1 c.2182A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MARCH1 c.11G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MARCH2 c.275G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MAT1A c.280G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MCCC1 c.667G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MCM6 c.1693C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MED12L c.5813C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MED23 c.2836C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MIB2 c.208C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MIER2 c.1453A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MIGA2 c.508G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MIPEP c.1678C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MLIP c.1145C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MMAB c.733G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MMP16 c.391C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MMP24 c.119_121delTGC
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MNT c.362C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MOV10L1 c.2459A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MRE11 c.1532delA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MRGPRE c.47G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MRGPRX4 c.69C>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MROH8 c.598G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MST1R c.931delG
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MTRNR2L3 c.2T>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUC12 c.9229C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUC16 c.1031G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUC19 c.18689G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUC4 c.7666G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUC4 c.8866G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MUT c.1532G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MYBPC2 c.3193G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MYH13 c.1440C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MYH9 c.4049_4051delAGG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MYLK3 c.1105C>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        MYO7A c.1091delC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NANOS1 c.517G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NBPF8 c.1714C>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NCAPG2 c.2617C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NCS1 c.250G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NEO1 c.3193G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NFASC c.1747G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NISCH c.4270C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NKX2-5 c.211G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NLGN4X c.166C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NLRP3 c.226G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NOC2L c.994G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NOMO2 c.976G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NOTCH1 c.1892A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NPHS1 c.3250delG
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NPTX2 c.979C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NTRK2 c.2272G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUDT16 c.5C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUDT7 c.259G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUDT9 c.480delG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUFIP1 c.1336G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUFIP1 c.415A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        NUP210 c.1159C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OBSCN c.11180G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OBSL1 c.4294C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OGDHL c.2591-11_2600delTGGTCCCTCAGGGACCAGCTT
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ONECUT2 c.751C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OPRM1 c.266C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OR8G5 c.716G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OSBPL2 c.543delC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        OVOL1 c.755C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PACS2 c.2428G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PADI2 c.95C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PALD1 c.1525G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PARD3 c.3457C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PARS2 c.599G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCCB c.372G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCDH9 c.3533C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCDH9 c.923C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCDHAC2 c.389C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCDHB13 c.1966G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCNX3 c.5516_5534delACTGTAGTGGGGGCGGTGG
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCSK4 c.328C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PCSK5 c.1543A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDE12 c.806_807delTG
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDE1B c.1220C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDE1C c.1733G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDGFRA c.1365-4C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDGFRA c.2645G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDGFRB c.2183+1G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDX1 c.172G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PDZRN3 c.2348C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PELP1 c.2285C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PGLYRP2 c.1711C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHACTR1 c.1248G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHACTR2 c.1429G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHF8 c.1499G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHF8 c.2385C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHLDB1 c.3146G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHLPP2 c.2843G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PHOX2B c.811C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PI4KA c.5701G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PID1 c.473C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIDD1 c.992A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIEZO1 c.3107G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIGG c.1087C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIGG c.2061G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PIN1 c.220C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PITPNC1 c.527G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PKHD1 c.5814G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLCB1 c.2279G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLEK2 c.458G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLEKHA5 c.1070C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLEKHG1 c.2273G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLEKHM1 c.2174G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLK5 c.505C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PLXNB1 c.4699G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PNPT1 c.1285-3_1288delAAGTTTCinsTTTTTTT
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PODXL2 c.1217G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        POLR2A c.1492G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        POM121C c.1456A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        POMT1 c.1648C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        POTEF c.505C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        POU3F3 c.259G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PPEF1 c.735C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PRAMEF11 c.1144A>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PREP c.815G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PRR14L c.3470A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PRSS55 c.43G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTPRS c.2192C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        PTPRS c.2872C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        QRICH2 c.3259G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        QSOX2 c.994C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        R3HCC1 c.309-1G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RAB21 c.41_43delCGG
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RAD50 c.1684G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RAD54L2 c.1012A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RALGAPA2 c.1332G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RAPH1 c.1993G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RASAL3 c.2062G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RASAL3 c.2155G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RASGRF2 c.123G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RASGRP4 c.1501G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RB1 c.2359C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RBL1 c.294A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RBM25 c.1438G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RBM43 c.167C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RBMXL3 c.1307G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RBPMS c.50A>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RFPL2 c.1018_1021delTTGCinsCTGT
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RFPL2 c.970A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RGPD3 c.2468A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RGS20 c.1145C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RIMS4 c.597G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RIMS4 c.730G>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RIOK3 c.1010C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNASEL c.1419A>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNF114 c.680A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNF123 c.3932C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNF185 c.254G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNF185 c.558G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RNF214 c.412G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999999999)
    999999 (999999 to 999999)
        RNH1 c.433G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RPAP3 c.1011delA
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RPL18 c.335G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RPL4 c.427C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RPS6KA2 c.1756G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RPS6KB2 c.37G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RRBP1 c.2335G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RTN1 c.1600C>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RTP5 c.281G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RUNDC1 c.337C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        RXFP2 c.604C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SACS c.2488G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SALL3 c.1837G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SAMHD1 c.405_421delCATTGATACACCTCAAT
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SAP30L c.193G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SAPCD1 c.119G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SBSN c.1583A>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SCAP c.2892delC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SEC14L1 c.1129C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SEC14L4 c.287G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SEC24D c.907G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SH2D3C c.898C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SIGLEC9 c.17_19delTGC
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SIRPG c.1141G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC22A8 c.583G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC26A4 c.575T>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC2A5 c.964G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC2A6 c.961G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC2A8 c.576delC
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC35F1 c.703G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC44A3 c.332A>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC5A10 c.1211G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC6A13 c.1341C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC8A1 c.2011A>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLC8A3 c.2374G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SLIT3 c.182G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SMARCA4 c.4185delA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SMARCAD1 c.1637G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SOBP c.1950G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SOGA1 c.1477G>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SOST c.278C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SOX18 c.698C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SP140 c.2167G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SP8 c.326G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SPATA31A6 c.1997A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SPATA31E1 c.2987G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SPINK2 c.118A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SPIRE2 c.470_472delAGG
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SPOCD1 c.3199G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SREBF2 c.85G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SSC4D c.1154C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SSH2 c.2626G>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SSPO c.13487A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SSPO c.1967G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SSTR1 c.121C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        STAC3 c.226_227insGGG
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        STK26 c.1073C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        STK33 c.1280G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        STK38L c.148G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        STK40 c.1198G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        STT3B c.957T>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SUDS3 c.397_399delAAG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SUSD3 c.428C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SYCP2 c.4180C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SYN2 c.544G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        SYNE2 c.9263G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TACC2 c.2488C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TACC2 c.3196G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TACC3 c.1847C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TAF1D c.281delA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TBL1X c.826C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TEKT4 c.824G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TET1 c.5408G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TEX264 c.875G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TFAP2E c.305C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TFRC c.1763G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TGM4 c.937G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        THEMIS2 c.1527_1531delTGTGAinsCGTGG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TIGD4 c.373G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TLN1 c.7088C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMC6 c.2054G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMCO6 c.464T>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM151A c.3G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM165 c.703C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM200B c.338G>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM232 c.1045G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM237 c.1159G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM59L c.800G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM63C c.2128C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM70 c.113G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TMEM94 c.859G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TNFSF18 c.355A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TNRC18 c.3076A>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TNRC6B c.4934G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TOGARAM1 c.2390A>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TOP2B c.1057C>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TOP2B c.247G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TPR c.583A>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TRDN c.1900G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TRIM61 c.365C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TRIM64B c.377delG
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TRPV1 c.1753A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TSEN2 c.247C>G
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TSEN2 c.451G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TSEN2 c.506G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TTK c.1324_1327delTCTA
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TTN c.68658G>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TTN c.68716C>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TTPA c.103G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TULP4 c.4571C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        TXNRD2 c.1522C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        UBASH3B c.32G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        UBE4A c.2306G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        USP32 c.2804G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        USPL1 c.3256G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        VGLL2 c.794C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        WDFY3 c.1262T>C
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        WDR18 c.1075C>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        XKR4 c.1918A>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        XPO4 c.238C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        XPO7 c.2398C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZAR1 c.1145C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZC3H12B c.2285G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZC3H12D c.1213C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZC3H7B c.1569C>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZC3H8 c.220G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZDBF2 c.5228C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZMPSTE24 c.1085dupT
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZMYM1 c.1965G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZMYM5 c.74C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZMYND15 c.1468G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF10 c.1658C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF207 c.673A>G
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF208 c.766T>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF276 c.548C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF365 c.307G>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF367 c.854G>A
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF37A c.1369C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF383 c.820C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF420 c.34G>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF431 c.1260G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF431 c.1462G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF431 c.1525G>C
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF474 c.757C>T
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF493 c.802G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF536 c.3551A>C
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF568 c.1066C>A
    999999 (999999 to 999999)
    0.0 (-56.1 to 56.1)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF680 c.1016A>G
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF696 c.430C>T
    999999 (999999 to 999999)
    33.3 (-41.5 to 79.2)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNF782 c.1630G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZNFX1 c.1982C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZP1 c.1103G>A
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ZYX c.697C>T
    999999 (999999 to 999999)
    -33.3 (-79.2 to 41.5)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
        ABCA5 c.725_727delCAGinsAAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ACSF3 c.1180C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ADAMTS2 c.2243C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ADCK2 c.253C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ADGRA1 c.227G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ADGRF3 c.1615G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ADGRG2 c.1314C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ADGRV1 c.16006C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        AFAP1 c.140A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        AHNAK c.14273A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        AHRR c.1881C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        AKAP13 c.5222C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        AKR1B15 c.452delT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ALS2CR12 c.1079C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ALX3 c.226G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        AMOTL2 c.2426G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ANK3 c.9349dupA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ANKRD33 c.112G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ANXA10 c.655G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        AP4B1 c.1657G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        APPBP2 c.863C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ARHGAP6 c.1393G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ARID1A c.492_494delCGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ARMC12 c.829G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ARSE c.1750C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ATM c.458G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ATM c.6889C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ATP10D c.545G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ATXN3 c.911_912insACAGCAGCAGCAGCAGCAGCAGCA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ATXN7 c.59_61delCGG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        BCR c.3055G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        BRIX1 c.494T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        BTG2 c.17G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        C10orf76 c.1715T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        C10orf82 c.343G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        C10orf95 c.581G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        C12orf56 c.989A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        C16orf86 c.922C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        C3 c.641C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CACFD1 c.665_668delCCCT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CAMKK2 c.1599_1601delGACinsAACAAAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CAPN13 c.1888A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CASKIN2 c.3538A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CASQ2 c.51C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CCDC106 c.138G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CCDC114 c.601A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CCDC144A c.1001C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CCDC168 c.15025G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CCDC25 c.137C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CCDC93 c.1321G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CCNI2 c.460G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        CCNL2 c.532A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        CCT3 c.591delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CD1B c.418G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CD7 c.44C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CDH17 c.1315G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CDK6 c.631G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CECR2 c.3651_3655dupAACCC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        CELSR1 c.5418G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CEP128 c.3073G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CEP290 c.5517G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CEP85L c.11G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CFAP36 c.685G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CFAP53 c.984_988delGAAACinsAAAAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CFAP65 c.2247G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CFAP97 c.481delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CGB3 c.16-2A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CHEK2 c.1409A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CIZ1 c.346C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CLCN1 c.2435_2445delAGCCTGTCTGT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CLCN3 c.1469G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CLDN19 c.503G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CLEC18C c.299T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CLN5 c.272C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CLPTM1L c.1295T>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        CNOT1 c.4630_4635delCTGTTAinsTTTTTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CNTN6 c.2759G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        COL11A2 c.2102C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        COL19A1 c.1703G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        COL27A1 c.1908G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CP c.2291C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CPB2 c.340delC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        CRYBG3 c.4646C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        CXCL6 c.86C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CXorf36 c.587G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        CYP11B2 c.1471C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        DCC c.601C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        DEPDC1B c.682G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        DHRS2 c.287A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        DHX29 c.3296C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        DLG5 c.2296G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        DNAAF3 c.976G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        DNAH9 c.6762G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        DOLPP1 c.500A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        DSC2 c.934G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        DST c.4384G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        EML5 c.824G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ENAM c.869G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ENO4 c.1751A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ENPEP c.1552G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        EOGT c.419C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        EPG5 c.6263T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        EREG c.143G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ESRP2 c.381G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        EXOSC10 c.1751C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        F13A1 c.1909-883_2038dup
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        F2RL1 c.280G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FAM186A c.4757_4828del
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        FAM193A c.1769C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FAM90A1 c.1261G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        FAM9B c.285G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FANCI c.153C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FARSB c.1177C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        FAT1 c.10630G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FBL c.407C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FGF10 c.365C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FIG4 c.2347G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        FIG4 c.2586A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        FNTA c.408C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FOXRED1 c.104C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FOXRED1 c.65G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        FXR2 c.994A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GAB3 c.1307C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GAGE2A c.175C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        GALR2 c.646C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GDF7 c.955C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GFRA1 c.665C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GGT1 c.1081G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GHR c.1705C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GIPR c.301C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GKAP1 c.424G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        GKAP1 c.427G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        GKAP1 c.432C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        GLP1R c.16G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GLYATL2 c.680A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GLYATL2 c.705A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GLYR1 c.1120G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GMNN c.161G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GNRH2 c.40_42delCTG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        GOLGA8A c.1463C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        GOLGA8A c.1505G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        GOLGA8A c.1538G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        GRIK4 c.2590C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        GRM7 c.2014G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        H2AFY c.10C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        HAUS5 c.425C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        HERC1 c.11036G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        HIF3A c.1573C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        HOXA13 c.396_398delCGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        HOXD13 c.120C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        HRH1 c.1048C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        HRNR c.7688G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        HSD17B12 c.682C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        HSPG2 c.8873C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        HUWE1 c.1553C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        HUWE1 c.1924G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        HUWE1 c.7633C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ICAM4 c.38dupT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        IGFN1 c.5612A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        IGFN1 c.5624C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        IL12RB1 c.1442G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ILF2 c.40_41delGGinsTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        IQSEC3 c.973G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ITGAD c.2240G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ITPR2 c.8022G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        JKAMP c.158G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        JPH3 c.169A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KIAA0513 c.646G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KIAA0895 c.720C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        KIAA1107 c.3152C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KIAA1107 c.3310C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KIF5C c.226G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KLHL34 c.1513G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KLHL9 c.825T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        KLRK1 c.197G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        KMT5C c.1141dupC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KNL1 c.1800G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        KRT13 c.610G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        KRTAP9-9 c.35_36insACCTGCTGCAGGACC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        LCA5L c.1198G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        LCAT c.625C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LCT c.1925C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LDB3 c.2012G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LILRB5 c.1274C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LMNA c.1977G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LMO7 c.1315T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        LOC100505841 c.50G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LOC101928841 c.3272G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LONRF3 c.712C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LRP2 c.13139dupC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LRRC4 c.912_913delTG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        LRRC40 c.1457C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        LRRK1 c.644G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        LTBP1 c.307C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MADD c.3458C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MAP2K2 c.1069C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MAZ c.272C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MED21 c.35T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MED23 c.2276dupA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        METTL5 c.388G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MICALL1 c.2475C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MIER3 c.1113delG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MMP2 c.1484G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MMP24 c.170_172delCGG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MRPL21 c.581G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MRVI1 c.1446delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MUC12 c.13432C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC12 c.2740T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC12 c.4291G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC12 c.5251A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MUC12 c.5512C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC12 c.5575G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC12 c.5612C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC16 c.17447G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MUC19 c.3641G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MUC4 c.3605T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC4 c.7039A>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MUC4 c.8259_10034dup
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MVD c.665G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MX1 c.454G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        MYCBP2 c.1826C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MYCBP2 c.3572C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MYH14 c.2935G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        MYOF c.1772_1773delAG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        MYOM3 c.221C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NALCN c.2063_2065delCCT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        NANOGNB c.495_501delGCATAAGinsAAAAAAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        NBEA c.5218G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        NCKIPSD c.1430C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        NEB c.17635-2_17635delAGAinsTTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NEK1 c.739C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NEPRO c.837delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NEUROD6 c.89A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NFATC1 c.179C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NHS c.2203C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NLRP12 c.2971C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NLRP14 c.3228G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NLRP6 c.176C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NMD3 c.754G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NPHP3 c.1525-4_1526delCTAGTAinsTTTTTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        NR2E1 c.592C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NRAP c.4058G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NRG2 c.2084G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NUCB1 c.664C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NUP98 c.2972C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        NYAP2 c.703G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        NYNRIN c.3662G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        OBSCN c.6543G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        OR13C5 c.243_244delGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        OR2T2 c.612_618delCGTGCTG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        OR2T2 c.785T>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        OR2T3 c.611T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        OR2T8 c.590T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        OR2W3 c.337C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        OR4C12 c.222_224delTTC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        OR51A4 c.497_500delGAAAinsCAAG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        OR52D1 c.127G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        OSMR c.937G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        OTOF c.5567G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PADI3 c.1739C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PCDH18 c.809C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PCDH8 c.1583G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PCLO c.2545G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        PGLYRP3 c.551G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        PGS1 c.1069A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        PIGO c.3116delT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        PKD1 c.2647C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PLD3 c.464C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        PLK2 c.328G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PLXNA1 c.1114C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PLXND1 c.1393G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        PML c.1753delC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PODXL2 c.1230delG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        POLQ c.6811C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        POLR2B c.632delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        POM121 c.1916A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        POM121C c.1162_1169delTTTGACTCinsCT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        POTEB2 c.119C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        PPP1R12C c.1907C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PPP2R2B c.1196G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        PPWD1 c.197-6_198delCTTCAGTCinsTTTTTTTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        PRAMEF2 c.280C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PRKDC c.2601C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        PROSER1 c.1587G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PRR19 c.355C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        PRRT3 c.543G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PRSS56 c.1646G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        PTPN13 c.4093G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        R3HDM2 c.79_80delAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RABGEF1 c.854C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        RAD50 c.2165delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        RAP2B c.56T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RASGEF1A c.1062delC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RBM15 c.1231G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        RBMX c.217-2_217-1delAGinsTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        RD3 c.292C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        RGPD1 c.4329A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        RGS17 c.55C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RIMBP2 c.2627C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RLBP1 c.307C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RNF128 c.103G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        RRN3 c.337A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        RSL1D1 c.1147-5_1147delCTTAGAinsTTTTTT
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        RSPH3 c.1186G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        RTTN c.5365G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        S100A7 c.139T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        SAMD13 c.169G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SCML2 c.654G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SCN1A c.1363C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        SCN7A c.2098G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SCRIB c.4063C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        SDK1 c.1769C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SDK2 c.4706C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SEC24A c.2346C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SEMA6D c.509C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SESN1 c.1469G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SFT2D3 c.314C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SHANK1 c.1329G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SHANK1 c.1366G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SHROOM2 c.2815C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SIX3 c.406_407delGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC30A10 c.1408C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SPTBN5 c.2405G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SPTLC1 c.1110C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ST7 c.1658G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        STARD9 c.1654C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        STK32A c.326G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        STRBP c.709C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        SVIL c.2083G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SYNE1 c.23551A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        SYNGR1 c.34G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        TACC2 c.798G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TCF7L1 c.40_42delGGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        TCTN2 c.127G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TEX30 c.132_133delTC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TFCP2L1 c.161C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TM4SF1 c.199T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TMEM202 c.603C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TMEM26 c.709G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TMEM72 c.490G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TMOD3 c.151C>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TMPO c.514A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TMPRSS6 c.435C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SKP1 c.21G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC25A12 c.887C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC2A11 c.995C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC35F2 c.448G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC38A2 c.549T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        SLC39A6 c.1088C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC5A2 c.236G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLC7A14 c.1963T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        SLC7A9 c.887G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SLU7 c.576delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        SOAT1 c.1421T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        SOCS6 c.781G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SORBS1 c.3400G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SP140 c.205G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SPATA31E1 c.2651G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        SPPL2B c.634G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TMPRSS6 c.943G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TNFAIP2 c.512_514delCGG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        TNXB c.8806G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TOGARAM2 c.2090C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TOP3B c.2299T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        TRIM17 c.232C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TRIM28 c.335G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TRIM3 c.2235G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TRIO c.9289G>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TRIP12 c.1099C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TSHZ1 c.1204G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TSPEAR c.59C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        TSSC4 c.538G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        TVP23A c.271T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        UBD c.3G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        UBE2O c.1813G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        UGDH c.1294delA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        UGGT2 c.3474-467_3480del
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        URI1 c.49G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        USP28 c.2845C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        USP34 c.1142C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        UTF1 c.302C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        VSTM2B c.457G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        VSTM2B c.603C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        WASHC2C c.1562A>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        WASHC2C c.691G>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        WDR33 c.160C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        WFS1 c.577_579delAAG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        WISP1 c.580A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        WWC1 c.2972T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        YBX3 c.40_42delACC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ZFPM1 c.2596C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ZNF148 c.2380_2383delGGCTinsAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ZNF185 c.1222G>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ZNF221 c.335C>T
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ZNF354C c.1060A>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ZNF366 c.1475T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ZNF41 c.1700_1702delAAA
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ZNF521 c.3122T>C
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ZNF550 c.157C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ZNF552 c.524_525dupGG
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ZNF552 c.533T>G
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
        ZNF628 c.794C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    -50.0 (-90.5 to 48.6)
        ZNF883 c.664C>A
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    0.0 (-65.8 to 65.8)
        ZSWIM6 c.82_84dupAGC
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    999999 (999999 to 999999)
    50.0 (-48.6 to 90.5)
    No statistical analyses for this end point

    Secondary: Number of Subjects With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort

    Close Top of page
    End point title
    Number of Subjects With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort [3]
    End point description
    To estimate the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that are adequate to meet the objectives of the study. Subjects of SA population in 7 cohorts.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [3] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    Cohort 1: Non-small cell lung carcinoma (NSCLC) monotherapy Cohort 2: NSCLC combination Cohort 3: Renal cell carcinoma (RCC) with clear cell component Cohort 4: HR+ HER2- adenocarcinoma of the breast Cohort 5: Castrate-resistant adenocarcinoma of the prostate Cohort 6: Castrate-resistant adenocarcinoma of the prostate Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Number of subjects analysed
    1
    4
    5
    10
    5
    10
    1
    Units: subjects
        SA
    1
    4
    5
    10
    5
    10
    1
        BE
    1
    4
    5
    8
    5
    8
    1
        BET
    0
    1
    3
    6
    4
    2
    1
        FBE
    0
    1
    1
    1
    1
    0
    0
    No statistical analyses for this end point

    Secondary: Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results by Cohort

    Close Top of page
    End point title
    Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results by Cohort [4]
    End point description
    In the BE (TBD) population, genetic alterations detected in blood using Guardant360 targeted NGS panel were compared to those detected in tissue using tempus targeted NGS panel. BE [targeted blood cfDNA (TBD)] population was analyzed. BE (TBD) population was defined as subjects in the BE population who had results of TBD NGS gene panel sample analysis from the post-progression blood sample.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [4] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The BE [targeted blood cfDNA (TBD)] Populations in Cohort 4 The BE (TBD) Populations in Cohort 5 & 6
    Number of subjects analysed
    8
    10
    Units: Percentage of subjects
        median (full range (min-max))
    11.9 (0.0 to 18.8)
    0.0 (0.0 to 16.7)
    No statistical analyses for this end point

    Secondary: Change in the Frequency of Alterations in Genes Encoding HLA, β2-Microglobulin, STAT1, JAK1, JAK2, IFN-γ and IFN-γR Between Pre-treatment Archival and Post-progression Samples

    Close Top of page
    End point title
    Change in the Frequency of Alterations in Genes Encoding HLA, β2-Microglobulin, STAT1, JAK1, JAK2, IFN-γ and IFN-γR Between Pre-treatment Archival and Post-progression Samples [5]
    End point description
    Mutations in specific genes encoding HLA, β2-Microglobulin, STAT1, JAK1, JAK2, IFN-γ and IFN-γR associated with immune function, have also been shown to impact tumor immunogenicity and response to anti-PD-1/-L1 treatment. Due to limited sample size for analysis, only SA populations were included in the final analysis. Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6. PD-1/-L1 inhibition analysis were only conducted in cohort 1, 2 and 3.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [5] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    Cohort 1: Non-small cell lung carcinoma (NSCLC) monotherapy Cohort 2: NSCLC combination Cohort 3: Renal cell carcinoma (RCC) with clear cell component
    Number of subjects analysed
    0 [6]
    0 [7]
    0 [8]
    Units: Percentage of subjects
        number (confidence interval 95%)
    ( to )
    ( to )
    ( to )
    Notes
    [6] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    [7] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    [8] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    No statistical analyses for this end point

    Secondary: Frequency of Alterations in Genes Encoding HLA, β2-Microglobulin, STAT1, JAK1, JAK2, IFN-γ and IFNGR in cfDNA.

    Close Top of page
    End point title
    Frequency of Alterations in Genes Encoding HLA, β2-Microglobulin, STAT1, JAK1, JAK2, IFN-γ and IFNGR in cfDNA. [9]
    End point description
    Mutations in specific genes encoding HLA, β2-Microglobulin, STAT1, JAK1, JAK2, IFN-γ and IFNGR in circulating free DNA (cfDNA) associated with immune function, have also been shown to impact tumor immunogenicity and response to anti-PD-1/-L1 treatment. Due to limited sample size for analysis, only SA populations were included in the final analysis. Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6. PD-1/-L1 inhibition analysis were only conducted in cohort 1, 2 and 3.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [9] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    Cohort 1: Non-small cell lung carcinoma (NSCLC) monotherapy Cohort 2: NSCLC combination Cohort 3: Renal cell carcinoma (RCC) with clear cell component
    Number of subjects analysed
    0 [10]
    0 [11]
    0 [12]
    Units: Percentage of subjects
        number (confidence interval 95%)
    ( to )
    ( to )
    ( to )
    Notes
    [10] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    [11] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    [12] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    No statistical analyses for this end point

    Secondary: Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples

    Close Top of page
    End point title
    Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples [13]
    End point description
    Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. BET Population and BET [WETD] Population were analyzed. The BET population was defined as subjects in the BE population who have a targeted tumor DNA panel biomarker result from both the archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all subjects in the BET population who have results of whole exome tumor DNA (WETD) NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [13] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The biomarker evaluable target (BET) Populations in Cohort 4 The BET (whole exome tumor DNA [WETD]) Populations in Cohort 4
    Number of subjects analysed
    6
    3
    Units: Percentage of subjects
        number (confidence interval 95%)
    0.0 (-39.0 to 39.0)
    -33.3 (-79.2 to 41.5)
    No statistical analyses for this end point

    Secondary: Percentage of Subjects Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA

    Close Top of page
    End point title
    Percentage of Subjects Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA [14]
    End point description
    Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. BE [TBD] was analyzed. BE (TBD) was defined as all subjects in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post- progression blood sample.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [14] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The BE [targeted blood cfDNA (TBD)] Populations in Cohort 4
    Number of subjects analysed
    8
    Units: Percentage of subjects
    number (confidence interval 95%)
        c.151G>T
    12.5 (2.2 to 47.1)
        c.184C>T
    12.5 (2.2 to 47.1)
        c.54_79delGGAACCCCCGGCACCGCCGCCGCCGC
    12.5 (2.2 to 47.1)
    No statistical analyses for this end point

    Secondary: Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples

    Close Top of page
    End point title
    Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples [15]
    End point description
    Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. BET Population and BET [WETD] Population was analyzed. The BET population was defined as subjects in the BE population who have a targeted tumor DNA panel biomarker result from both the archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all subjects in the BET population who have results of whole exome tumor DNA (WETD) NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [15] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The BET Populations in Cohort 5 & 6 The BET (WETD) Populations in Cohort 5 & 6
    Number of subjects analysed
    6
    2
    Units: Percentage of subjects
        number (confidence interval 95%)
    0.0 (-39.0 to 39.0)
    0.0 (-65.8 to 65.8)
    No statistical analyses for this end point

    Secondary: Percentage of Subjects Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA

    Close Top of page
    End point title
    Percentage of Subjects Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA [16]
    End point description
    Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. BE [TBD] was analyzed. BE (TBD) was defined as all subjects in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post- progression blood sample.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [16] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The BE (TBD) Populations in Cohort 5 & 6
    Number of subjects analysed
    10
    Units: Percentage of subjects
    number (confidence interval 95%)
        c.2105T>A
    20.0 (5.7 to 51.0)
        c.2202G>C
    10.0 (1.8 to 40.4)
        c.2632A>G
    10.0 (1.8 to 40.4)
    No statistical analyses for this end point

    Secondary: Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples

    Close Top of page
    End point title
    Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples [17]
    End point description
    The differences in the expression of nuclear HR reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET (TTR) population and Tempus RNAseq in BET (WTTR) population. BET [targeted tumor RNA (TTR)] Population and BET [whole transcriptome tumor RNA (WTTR)] Population were analyzed. BET (TTR) was defined as all subjects in the BET population who have results of TTR sample analysis from both the archival and de novo biopsy tumor tissue biospecimen. BET (WTTR) was defined as all subjects in the BET population who have results of WTTR NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [17] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    The BET [targeted tumor RNA (TTR)] Populations in Cohort 5 & 6 The BET [WTTR] Populations in Cohort 5 & 6
    Number of subjects analysed
    2
    6
    Units: Units on a scale
    arithmetic mean (confidence interval 95%)
        ESR1
    0.3 (-16.4 to 17.1)
    25.6 (-11.2 to 62.5)
        ESR2
    -0.4 (-6.3 to 5.5)
    -1.1 (-2.3 to 0.1)
        NR3C1
    0.5 (-1.2 to 2.1)
    5.4 (-30.7 to 41.5)
        NR3C2
    999999 (999999 to 999999)
    3.7 (-18.2 to 25.6)
        PGR
    -0.5 (-13.4 to 12.4)
    2.0 (-3.9 to 7.9)
        AR
    -0.7 (-10.9 to 9.4)
    549.9 (-480.1 to 1579.9)
    No statistical analyses for this end point

    Secondary: Change in the Frequency of Somatic Reversion Alterations in gBRCA Mutant Allele Between Pre-treatment Archival and Post-progression Samples.

    Close Top of page
    End point title
    Change in the Frequency of Somatic Reversion Alterations in gBRCA Mutant Allele Between Pre-treatment Archival and Post-progression Samples. [18]
    End point description
    PARP inhibitors induce synthetic lethality in tumor cells bearing mutations and/or deletions in genes involved in homologous recombination or other DNA repair pathways, most notably BRCA genes. Somatic reversion of gBRCA gene alterations was evaluated as a mechanism of resistance to monotherapy PARP inhibition. Due to limited sample size for analysis, only SA populations were included in the final analysis. Secondary endpoints were analyzed and reported only for Cohort 4 and for Cohort 5&6. PARP inhibition analysis were only conducted in cohort 7.
    End point type
    Secondary
    End point timeframe
    Through study completion, approximately 3 months
    Notes
    [18] - The end point is not reporting statistics for all the arms in the baseline period. It is expected all the baseline period arms will be reported on when providing values for an end point on the baseline period.
    Justification: Analysis was planned only for the arms specified.
    End point values
    Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Number of subjects analysed
    0 [19]
    Units: Percentage of subjects
        number (confidence interval 95%)
    ( to )
    Notes
    [19] - Secondary endpoints were analyzed and reported only in Cohort 4 and for Cohort 5&6.
    No statistical analyses for this end point

    Adverse events

    Close Top of page
    Adverse events information
    Timeframe for reporting adverse events
    From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider’s facility
    Assessment type
    Non-systematic
    Dictionary used for adverse event reporting
    Dictionary name
    MedDRA
    Dictionary version
    23.1
    Reporting groups
    Reporting group title
    Cohort 1: NSCLC monotherapy
    Reporting group description
    Progressive disease on 1st line monotherapy anti-PD-1/-L1.

    Reporting group title
    Cohort 2: NSCLC combination
    Reporting group description
    Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.

    Reporting group title
    Cohort 3: RCC with clear cell component
    Reporting group description
    Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.

    Reporting group title
    Cohort 4: HR+ HER2- adenocarcinoma of the breast
    Reporting group description
    Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.

    Reporting group title
    Cohort 5: Castrate-resistant adenocarcinoma of the prostate
    Reporting group description
    Progressive disease on enzalutamide monotherapy.

    Reporting group title
    Cohort 6: Castrate-resistant adenocarcinoma of the prostate
    Reporting group description
    Progressive disease on abiraterone in combination with prednisone.

    Reporting group title
    Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Reporting group description
    Progressive disease on a PARP inhibitor monotherapy in subjects previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.

    Serious adverse events
    Cohort 1: NSCLC monotherapy Cohort 2: NSCLC combination Cohort 3: RCC with clear cell component Cohort 4: HR+ HER2- adenocarcinoma of the breast Cohort 5: Castrate-resistant adenocarcinoma of the prostate Cohort 6: Castrate-resistant adenocarcinoma of the prostate Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Total subjects affected by serious adverse events
         subjects affected / exposed
    0 / 1 (0.00%)
    0 / 4 (0.00%)
    0 / 5 (0.00%)
    0 / 10 (0.00%)
    0 / 5 (0.00%)
    0 / 10 (0.00%)
    0 / 1 (0.00%)
         number of deaths (all causes)
    0
    0
    0
    0
    0
    0
    0
         number of deaths resulting from adverse events
    Frequency threshold for reporting non-serious adverse events: 0%
    Non-serious adverse events
    Cohort 1: NSCLC monotherapy Cohort 2: NSCLC combination Cohort 3: RCC with clear cell component Cohort 4: HR+ HER2- adenocarcinoma of the breast Cohort 5: Castrate-resistant adenocarcinoma of the prostate Cohort 6: Castrate-resistant adenocarcinoma of the prostate Cohort 7: gBRCAm HER2- adenocarcinoma of the breast
    Total subjects affected by non serious adverse events
         subjects affected / exposed
    0 / 1 (0.00%)
    0 / 4 (0.00%)
    0 / 5 (0.00%)
    1 / 10 (10.00%)
    1 / 5 (20.00%)
    0 / 10 (0.00%)
    0 / 1 (0.00%)
    Injury, poisoning and procedural complications
    Post procedural contusion
         subjects affected / exposed
    0 / 1 (0.00%)
    0 / 4 (0.00%)
    0 / 5 (0.00%)
    1 / 10 (10.00%)
    0 / 5 (0.00%)
    0 / 10 (0.00%)
    0 / 1 (0.00%)
         occurrences all number
    0
    0
    0
    1
    0
    0
    0
    Procedural pain
         subjects affected / exposed
    0 / 1 (0.00%)
    0 / 4 (0.00%)
    0 / 5 (0.00%)
    1 / 10 (10.00%)
    0 / 5 (0.00%)
    0 / 10 (0.00%)
    0 / 1 (0.00%)
         occurrences all number
    0
    0
    0
    1
    0
    0
    0
    Nervous system disorders
    Syncope
         subjects affected / exposed
    0 / 1 (0.00%)
    0 / 4 (0.00%)
    0 / 5 (0.00%)
    0 / 10 (0.00%)
    1 / 5 (20.00%)
    0 / 10 (0.00%)
    0 / 1 (0.00%)
         occurrences all number
    0
    0
    0
    0
    1
    0
    0
    Skin and subcutaneous tissue disorders
    Dermatitis contact
         subjects affected / exposed
    0 / 1 (0.00%)
    0 / 4 (0.00%)
    0 / 5 (0.00%)
    1 / 10 (10.00%)
    0 / 5 (0.00%)
    0 / 10 (0.00%)
    0 / 1 (0.00%)
         occurrences all number
    0
    0
    0
    1
    0
    0
    0

    More information

    Close Top of page

    Substantial protocol amendments (globally)

    Were there any global substantial amendments to the protocol? Yes
    Date
    Amendment
    12 May 2020
    Schedule of Activities updated to reflect changes to Informed Consent and Screening process. Section 3. Study design description updated to reflect changes to Informed Consent and Screening process. Figure 1 Study schema updated to reflect changes to Informed Consent and Screening process. Table 1 updated to reflect changes to permitted anti-cancer therapies and estimated cohort size. Inclusion Criterion 1c revised to allow specific axitinib combinations in order to reflect current standard of care therapy. Subject enrollment cohorts 1 and 2 combined and cohort sample size decreased by a total of 50 in order to reflect current standard of care therapy. Prior Protocol Administrative Clarification Letters (PACLs) incorporated (Section 4.1). Pre-screening and main Informed Consent processes merged in order to simplify the consent process (Section 5). Window defined for de novo tumor tissue biopsy laboratory shipment in order to allow operational flexibility while maintaining timely return of Next Generation Sequencing analyses (Section 5.2.1.2). Window defined for research blood draws in order to allow operational flexibility while maintaining a collection date contemporaneous with the de novo tumor tissue biopsy (Section 5.2.1.3). Clarification added regarding screening (Section 5.1), re-screening (Section 5.1.5), enrollment (Section 5.2), and follow-up (Section 5.3) activities. Clarification added regarding allowing subjects to subject in other concurrent investigational treatment clinical trials, with prior Sponsor agreement (Section 5.1.2). Clarification added regarding adverse event reporting. Sample size determination re-worded for clarity. Appendix 2 Subject Assessment Questionnaire updated to reflect current version. Appendix 3 Physician Assessment Questionnaire updated to reflect current version. Country-Specific (France) Contrat Unique added to Appendix. Administrative updates made throughout to ensure consistent terminology.

    Interruptions (globally)

    Were there any global interruptions to the trial? No

    Limitations and caveats

    Limitations of the trial such as small numbers of subjects analysed or technical problems leading to unreliable data.
    Because of the global COVID-19 pandemic and the observed high failure rate of tumor biospecimen analyses, the study was terminated in October 2020. This decision was not made as a result of any safety concerns or regulatory interactions.
    For support, Contact us.
    The status and protocol content of GB trials is no longer updated since 1 January 2021. For the UK, as of 31 January 2021, EU Law applies only to the territory of Northern Ireland (NI) to the extent foreseen in the Protocol on Ireland/NI. Legal notice
    As of 31 January 2023, all EU/EEA initial clinical trial applications must be submitted through CTIS . Updated EudraCT trials information and information on PIP/Art 46 trials conducted exclusively in third countries continues to be submitted through EudraCT and published on this website.

    European Medicines Agency © 1995-Mon Jun 30 01:22:28 CEST 2025 | Domenico Scarlattilaan 6, 1083 HS Amsterdam, The Netherlands
    EMA HMA